Monoclonal Antibody Anti Mouse Fap

Lab Reagents

Human IgG antibody Laboratories manufactures the monoclonal antibody anti mouse fap reagents distributed by Genprice. The Monoclonal Antibody Anti Mouse Fap reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact mouse monoclonal. Other Monoclonal products are available in stock. Specificity: Monoclonal Category: Antibody Group: Anti Mouse

Anti Mouse information

Prolyl Endopeptidase FAP (Fap) Antibody

abx031162-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Prolyl Endopeptidase FAP (FAP) Antibody

20-abx320182
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FAP antibody

20R-FR012 50 ug
EUR 656
Description: Rabbit polyclonal FAP antibody

FAP Antibody

36465-100ul 100ul
EUR 252

FAP Antibody

CSB-PA101830-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FAP. Recognizes FAP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

FAP Antibody

CSB-PA101830-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FAP. Recognizes FAP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

FAP Antibody

1-CSB-PA614259ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FAP. Recognizes FAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FAP Antibody

1-CSB-PA949422
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FAP. Recognizes FAP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

FAP Antibody

1-CSB-PA699536
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FAP. Recognizes FAP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

FAP Antibody

1-CSB-PA008191
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FAP. Recognizes FAP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Mouse Fap/ Prolyl endopeptidase FAP ELISA Kit

E0506Mo 1 Kit
EUR 632

FAP

EF006808 96 Tests
EUR 689

FAP-1 Antibody

33369-100ul 100ul
EUR 252

FAP-1 Antibody

33369-50ul 50ul
EUR 187

Seprase (FAP) Antibody

20-abx212884
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Seprase (FAP) Antibody

20-abx212885
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FAP alpha Antibody

20-abx134947
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

FAP 1 Antibody

abx149914-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

FAP-1 Antibody

abx011419-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

FAP-1 Antibody

AF0739 200ul
EUR 304
Description: FAP-1 Antibody detects endogenous levels of FAP-1.

FAP Conjugated Antibody

C36465 100ul
EUR 397

Seprase (FAP) Antibody

abx331563-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Seprase (FAP) Antibody

20-abx328406
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

FAP 1 Antibody

ABF5344 100 ug
EUR 438

FAP- 1 Antibody

ABF0739 100 ug
EUR 438

Anti-FAP-SMCC-DM1 ADC

ADC-W-593 1mg Ask for price
Description: This ADC product is comprised of an anti-FAP monoclonal antibody conjugated via a SMCC linker to DM1

Anti-Fibroblast activation protein, alpha/FAP Antibody

A00422-1 100ug/vial
EUR 294

Rabbit Anti Human Fap Alpha Polyclonal Antibody

CPBT-67607RH 50 µg
EUR 985

Anti-Fibroblast activation protein, alpha/FAP Antibody

PA1913 100ug/vial
EUR 334

Mouse FAP shRNA Plasmid

20-abx970281
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FAP Recombinant Protein (Mouse)

RP133745 100 ug Ask for price

Fap ELISA Kit| Mouse Prolyl endopeptidase FAP ELISA Kit

EF014918 96 Tests
EUR 689

FAP siRNA

20-abx916480
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FAP siRNA

20-abx916481
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Recombinant Anti-CD3 x Anti-FAP Bispecific Antibody (CrossMab)

CROSSAB-080 200μg Ask for price
Description: A bispecific antibody that is expressed as four chains with knobs-into-holes mutations and domain crossover. After one or multi-steps purification, high-purity antibody can be obtained. This BsAb can retarget T cells to tumor cells. It is designed for the research of Epithelial cancers therapy.

Polyclonal Mouse Fap Antibody(N-term)

APR04457G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Fap (N-term). This antibody is tested and proven to work in the following applications:

FAP-1 Conjugated Antibody

C33369 100ul
EUR 397

FAP-1 Polyclonal Antibody

ABP58529-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human FAP-1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FAP-1 from Human, Mouse, Rat. This FAP-1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FAP-1 protein

FAP-1 Polyclonal Antibody

ABP58529-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FAP-1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FAP-1 from Human, Mouse, Rat. This FAP-1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FAP-1 protein

FAP-1 Polyclonal Antibody

ABP58529-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FAP-1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FAP-1 from Human, Mouse, Rat. This FAP-1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FAP-1 protein

FAP-1 Polyclonal Antibody

ES8916-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FAP-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FAP-1 Polyclonal Antibody

ES8916-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FAP-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-FAP (Sibrotuzumab)-SMCC-DM1 ADC

ADC-W-1130 1mg Ask for price
Description: This ADC product is comprised of an anti-FAP monoclonal antibody conjugated via a SMCC linker to DM1

Anti-FAP (Sibrotuzumab)-SPDB-DM4 ADC

ADC-W-1131 1mg Ask for price
Description: This ADC product is comprised of an anti-FAP monoclonal antibody conjugated via a SPDB linker to DM4

Anti-FAP (Sibrotuzumab)-MC-MMAF ADC

ADC-W-1132 1mg Ask for price
Description: This ADC product is comprised of an anti-FAP monoclonal antibody conjugated via a MC linker to MMAF

Human FAP/ Prolyl endopeptidase FAP ELISA Kit

E0862Hu 1 Kit
EUR 605

Mouse Seprase, Fap ELISA KIT

ELI-18340m 96 Tests
EUR 865

Mouse Seprase(FAP) ELISA kit

CSB-EL008424MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Seprase (FAP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Seprase(FAP) ELISA kit

1-CSB-EL008424MO
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Seprase(FAP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Seprase (FAP) ELISA Kit

abx555647-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Recombinant mouse Prolyl endopeptidase FAP

P1417 100ug Ask for price
  • Uniprot ID: P97321
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for mouse Prolyl endopeptidase FAP

Fap ORF Vector (Mouse) (pORF)

ORF044583 1.0 ug DNA
EUR 506

FAP ELISA Kit (Mouse) (OKAN06455)

OKAN06455 96 Wells
EUR 792
Description: Description of target: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 13.4 pg/mL

FAP ELISA Kit (Mouse) (OKCD00760)

OKCD00760 96 Wells
EUR 857
Description: Description of target: Cell surface glycoprotein serine protease that participates in extracellular matrix degradation and involved in many cellular processes including tissue remodeling, fibrosis, wound healing, inflammation and tumor growth. Both plasma membrane and soluble forms exhibit post-proline cleaving endopeptidase activity, with a marked preference for Ala/Ser-Gly-Pro-Ser/Asn/Ala consensus sequences, on substrate such as alpha-2-antiplasmin SERPINF2 and SPRY2. Degrade also gelatin, heat-denatured type I collagen, but not native collagen type I and IV, vibronectin, tenascin, laminin, fibronectin, fibrin or casein. Have also dipeptidyl peptidase activity, exhibiting the ability to hydrolyze the prolyl bond two residues from the N-terminus of synthetic dipeptide substrates provided that the penultimate residue is proline, with a preference for Ala-Pro, Ile-Pro, Gly-Pro, Arg-Pro and Pro-Pro. Natural neuropeptide hormones for dipeptidyl peptidase are the neuropeptide Y (NPY), peptide YY (PYY), substance P (TAC1) and brain natriuretic peptide 32 (NPPB). The plasma membrane form, in association with either DPP4, PLAUR or integrins, is involved in the pericellular proteolysis of the extracellular matrix (ECM), and hence promotes cell adhesion, migration and invasion through the ECM. Plays a role in tissue remodeling during development and wound healing. Participates in the cell invasiveness towards the ECM in malignant melanoma cancers. Enhances tumor growth progression by increasing angiogenesis, collagen fiber degradation and apoptosis and by reducing antitumor response of the immune system. Promotes glioma cell invasion through the brain parenchyma by degrading the proteoglycan brevican. Acts as a tumor suppressor in melanocytic cells through regulation of cell proliferation and survival in a serine protease activity-independent manner.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

FAP cloning plasmid

CSB-CL614259HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2283
  • Sequence: atgaagacttgggtaaaaatcgtatttggagttgccacctctgctgtgcttgccttattggtgatgtgcattgtcttacgcccttcaagagttcataactctgaagaaaatacaatgagagcactcacactgaaggatattttaaatggaacattttcttataaaacattttttc
  • Show more
Description: A cloning plasmid for the FAP gene.

FAP Rabbit pAb

A6349-100ul 100 ul
EUR 308

FAP Rabbit pAb

A6349-200ul 200 ul
EUR 459

FAP Rabbit pAb

A6349-20ul 20 ul
EUR 183

FAP Rabbit pAb

A6349-50ul 50 ul
EUR 223

Polyclonal FAP Alpha Antibody (Internal)

APR02692G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FAP Alpha (Internal). This antibody is tested and proven to work in the following applications:

Fap sgRNA CRISPR Lentivector set (Mouse)

K3418001 3 x 1.0 ug
EUR 339

Mouse Anti-Adenovirus Monoclonal Antibody

DMAB2923-05mg 0.5 mg
EUR 780

Mouse Anti-Adenovirus Monoclonal Antibody

DMAB2923-1mg 1 mg
EUR 1099

Mouse Anti-Adenovirus Monoclonal Antibody

DMAB2924-05mg 0.5 mg
EUR 897

Mouse Anti-Adenovirus Monoclonal Antibody

DMAB2924-1mg 1 mg
EUR 1339

Mouse Anti-Adenovirus Monoclonal Antibody

DMAB2926 1 mg
EUR 689

Mouse Anti-Adenovirus Monoclonal Antibody

DMAB2929 1 mg
EUR 689

Mouse Anti-Astrovirus Monoclonal Antibody

DMAB3010 1 mg
EUR 741

Mouse Anti-Astrovirus Monoclonal Antibody

DMAB3011 1 mg
EUR 903

Mouse Anti-WNV Monoclonal Antibody

DMAB4513-05mg 0.5 mg
EUR 969

Mouse Anti-WNV Monoclonal Antibody

DMAB4513-1mg 1 mg
EUR 1469

Mouse Anti-WNV Monoclonal Antibody

DMAB4515 1 mg
EUR 1339

Mouse Anti Vimentin Monoclonal Antibody

DMABT-47867MV 1 ml
EUR 767

Mouse Anti Aldosterone Monoclonal Antibody

DMABT-49079MA 0.2 mg
EUR 580

Mouse Anti Aldosterone Monoclonal Antibody

DMABT-49080MA 0.2 mg
EUR 580

Mouse Anti Aldosterone Monoclonal Antibody

DMABT-49081MA 0.2 mg
EUR 580

Mouse Anti Cortisol Monoclonal Antibody

DMABT-49107MC 0.2 mg
EUR 580

Mouse Anti Cortisol Monoclonal Antibody

DMABT-49109MC 0.2 mg
EUR 580

Mouse Anti Cortisol Monoclonal Antibody

DMABT-49111MC 0.2 mg
EUR 580

Mouse Anti Progesterone Monoclonal Antibody

DMABT-49173MP 0.2 mg
EUR 580

Mouse Anti Progesterone Monoclonal Antibody

DMABT-49175MP 0.2 mg
EUR 580

Mouse Anti Progesterone Monoclonal Antibody

DMABT-49176MP 1 mg
EUR 663

Mouse Anti Progesterone Monoclonal Antibody

DMABT-49177MP 1 mg
EUR 663

Mouse Anti Progesterone Monoclonal Antibody

DMABT-49178MP 1 mg
EUR 892

Mouse Anti Progesterone Monoclonal Antibody

DMABT-49179MP 0.2 mg
EUR 663

Mouse Anti Testosterone Monoclonal Antibody

DMABT-49194MT 0.2 mg
EUR 767

Mouse Anti Testosterone Monoclonal Antibody

DMABT-49196MT 0.2 mg
EUR 741

Mouse Anti Testosterone Monoclonal Antibody

DMABT-49197MT 0.2 mg
EUR 580

Mouse Anti Testosterone Monoclonal Antibody

DMABT-49199MT 0.2 mg
EUR 663

Mouse Anti Thyroxine Monoclonal Antibody

DMABT-49206MT 1 mg
EUR 580

Mouse Anti Thyroxine Monoclonal Antibody

DMABT-49207MT 1 mg
EUR 580

Mouse Anti Thyroxine Monoclonal Antibody

DMABT-49208MT 1 mg
EUR 580

Mouse Anti Triiodothyronine Monoclonal Antibody

DMABT-49209MT 1 mg
EUR 580

Mouse Anti Brdu Monoclonal Antibody

DMABT-50295MB 20 µg
EUR 445

Mouse Anti Brdu Monoclonal Antibody

DMABT-50296MB 0.2 mg
EUR 715

Mouse Anti Adenovirus Monoclonal Antibody

DMABT-51065MA 1 ml
EUR 710

Mouse Anti Adenovirus Monoclonal Antibody

DMABT-51066MA 1 mg
EUR 767

Mouse Anti Aspergillus Monoclonal Antibody

DMABT-51085MA 0.2 mg
EUR 741

Mouse Anti Astrovirus Monoclonal Antibody

DMABT-51096MA 1 mg
EUR 881

Mouse Anti Cytomegalovirus Monoclonal Antibody

DMABT-51183MC 0.1 mg
EUR 767

Mouse Anti Rotavirus Monoclonal Antibody

DMABT-51527MR 0.1 mg
EUR 767

Mouse Anti Rotavirus Monoclonal Antibody

DMABT-51528MR 0.1 mg
EUR 767

Mouse Anti Rotavirus Monoclonal Antibody

DMABT-51529MR 0.1 mg
EUR 767

Mouse Anti Gst Monoclonal Antibody

DMABT-54781MG 2 ml
EUR 715

Mouse Anti Biotin Monoclonal Antibody

DMABT-54801MB 0.2 mg
EUR 580

Mouse Anti Ovalbumin Monoclonal Antibody

DMABT-54810MO 0.1 mg
EUR 559

Mouse Anti Phosphotyrosine Monoclonal Antibody

DMABT-54833MP 0.5 mg
EUR 559

Mouse Anti Barbiturates Monoclonal Antibody

DMABT-54852MB 1 mg
EUR 861

Mouse Anti Methadone Monoclonal Antibody

DMABT-54862MM 1 mg
EUR 881

Mouse Anti Methadone Monoclonal Antibody

DMABT-54863MM 0.5 mg
EUR 741

Mouse Anti Morphine Monoclonal Antibody

DMABT-54866MM 1 mg
EUR 985

Mouse Anti Phencyclidine Monoclonal Antibody

DMABT-54868MP 0.2 mg
EUR 663

Mouse Anti Propoxyphene Monoclonal Antibody

DMABT-54869MP 1 mg
EUR 881

Mouse Anti Tetrahydrocannabinol Monoclonal Antibody

DMABT-54873MT 0.2 mg
EUR 663

Mouse Anti Metapneumovirus Monoclonal Antibody

DMABT-54897MM 0.2 mg
EUR 819

Mouse Anti Amphetamine Monoclonal Antibody

DMABT-54900MA 1 mg
EUR 767

Mouse Anti Benzoylecgonine Monoclonal Antibody

DMABT-54902MB 1 mg
EUR 767

Mouse Anti Benzoylecgonine Monoclonal Antibody

DMABT-54903MB 1 mg
EUR 767

Mouse Anti Methadone Monoclonal Antibody

DMABT-54905MM 1 mg
EUR 767

Mouse Anti Tetrahydrocannabinol Monoclonal Antibody

DMABT-54908MT 1 mg
EUR 767

Mouse Anti Tetrahydrocannabinol Monoclonal Antibody

DMABT-54909MT 1 mg
EUR 767

Mouse Anti Tetrahydrocannabinol Monoclonal Antibody

DMABT-54910MT 1 mg
EUR 767

Mouse Anti Carbamazepine Monoclonal Antibody

DMABT-54912MC 1 mg
EUR 767

Mouse Anti Gentamicin Monoclonal Antibody

DMABT-54913MG 1 mg
EUR 767

Mouse Anti Gentamicin Monoclonal Antibody

DMABT-54914MG 1 mg
EUR 767

Mouse Anti Phenobarbital Monoclonal Antibody

DMABT-54915MP 1 mg
EUR 767

Mouse Anti Phenobarbital Monoclonal Antibody

DMABT-54916MP 1 mg
EUR 767

Mouse Anti Phenytoin Monoclonal Antibody

DMABT-54917MP 1 mg
EUR 767

Mouse Anti Phenytoin Monoclonal Antibody

DMABT-54918MP 1 mg
EUR 767

Mouse Anti Vancomycin Monoclonal Antibody

DMABT-54924MV 1 mg
EUR 767

Mouse Anti-KIAA0101 Monoclonal Antibody

DMABT-H14116 100ug
EUR 767

Mouse Anti-EDN1 Monoclonal Antibody

DMABT-H3305MH-05mg 0.5 mg
EUR 897

Mouse Anti-EDN1 Monoclonal Antibody

DMABT-H3305MH-1mg 1 mg
EUR 1339

Mouse Anti-HP Monoclonal Antibody

DMABT-H3687 1mg
EUR 715

Mouse anti Rotavirus Monoclonal Antibody

DCAB-TJ116 1 mg
EUR 1339

Mouse anti Rotavirus Monoclonal Antibody

DCAB-TJ117 1 mg
EUR 1339

Mouse anti Rotavirus Monoclonal Antibody

DCAB-TJ118 1 mg
EUR 1339

Mouse Anti Agrin Monoclonal Antibody

CABT-50791MA 0.2 mg
EUR 1334

Mouse Anti Huntingtin Monoclonal Antibody

CABT-51054MH 0.1 mg
EUR 715

Mouse Anti Atic Monoclonal Antibody

CABT-54798MA 0.1 mg
EUR 559

Mouse Anti Cdk4 Monoclonal Antibody

CABT-54824MC 0.1 mg
EUR 944

Mouse Anti-Galactomannan monoclonal antibody

CABT-B226 Supernatant, 5mL
EUR 710

Mouse Anti-GOLGA1 monoclonal antibody

CABT-B229 1mL
EUR 663

Mouse Anti-TNRC6A monoclonal antibody

CABT-B231 5mL
EUR 725

Mouse Anti-Homogalacturonan monoclonal antibody

CABT-B232 Supernatant, 5mL
EUR 710

Mouse Anti-Haptoglobin monoclonal antibody

CABT-BL8834 1.0 mg
EUR 991

Mouse Anti-Haptoglobin monoclonal antibody

CABT-BL8835 1.0 mg
EUR 991

Mouse Anti-Haptoglobin monoclonal antibody

CABT-BL8836 1.0 mg
EUR 991

Mouse Anti-Haptoglobin monoclonal antibody

CABT-BL8837 1.0 mg
EUR 991

Mouse Anti-PEDV monoclonal antibody

CABT-BL8885 1.0 mg
EUR 892

Mouse Anti-PEDV monoclonal antibody

CABT-BL8886 1.0 mg
EUR 892

Mouse Monoclonal antibody Anti CD177

CD177ACMO 0,1 mg
EUR 349

Mouse Anti-GAPDH Monoclonal Antibody

AKR-001 100 µg
EUR 508
Description: Mouse Anti-GAPDH Monoclonal Antibody is Protein A purified and provided at 1 mg/mL. Suitable for Western blot or Immunostaining. 100 µg.

Mouse Anti-GFP Monoclonal Antibody

AKR-020 100 µg
EUR 508
Description: Mouse Anti-GFP Monoclonal Antibody is Protein A purified and provided at 1 mg/mL. Suitable for Western blot or Immunostaining. 100 µg.

Mouse Anti-RFP Monoclonal Antibody

AKR-021 100 µg
EUR 508
Description: Mouse Anti-RFP Monoclonal Antibody recognizes Tag-RFP, Turbo-RFP, mCherry and mOrange. Suitable for Western Blot, Dot Blot, Immunostaining or ELISA. Clone RF5R. 100 µg.

Anti-TM9SF3 Mouse Monoclonal Antibody

A1516-50
EUR 446

Mouse Monoclonal Antibody Anti-GST

GSTACMO 0,1 mg
EUR 204.7

Mouse Monoclonal antibody Anti-IL17D

IL17DACMO 0,1 mg
EUR 349

Mouse Monoclonal antibody Anti-IL7D

IL7ACMO 0,1 mg
EUR 349

Mouse Monoclonal Antibody Anti-IL8

IL8ACMO 0,1 mg
EUR 349

Mouse Anti-Methylglyoxal Monoclonal Antibody

STA-011 100 µg
EUR 508
Description: Mouse Anti-Methylglyoxal Monoclonal Antibody recognizes methyglyoxal adducts on proteins from any species. This antibody works in Western blot and immunohistochemistry. 100 µg.

Anti-FAP (Sibrotuzumab)-MC-Vc-PAB-MMAE ADC

ADC-W-1133 1mg Ask for price
Description: This ADC product is comprised of an anti-FAP monoclonal antibody conjugated via a MC-Vc linker to MMAE

Anti-FAP (Sibrotuzumab)-MC-Vc-PAB-SN38 ADC

ADC-W-1134 1mg Ask for price
Description: This ADC product is comprised of an anti-FAP monoclonal antibody conjugated via a MC-Vc-PAB linker to SN38

Mouse Anti Mouse Cd44 Monoclonal Antibody

CABT-46107MM 0.25 mg
EUR 663

Polyclonal FAP Alpha Antibody (Extracellular Domain)

APR02074G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FAP Alpha (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal FAP Alpha Antibody (Extracellular Domain)

APR02075G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FAP Alpha (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Fibroblast Activation Protein Alpha (FAP) Antibody

abx411932-50ug 50 ug
EUR 704
  • Shipped within 1 week.

FAP alpha Blocking Peptide

20-abx061646
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

FAP ELISA KIT|Human

EF004980 96 Tests
EUR 689

FAP-1 Blocking Peptide

AF0739-BP 1mg
EUR 195

Human FAP shRNA Plasmid

20-abx951527
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FAP Recombinant Protein (Human)

RP011767 100 ug Ask for price

FAP Recombinant Protein (Rat)

RP200843 100 ug Ask for price

Anti-Procalcitonin antibody *Mouse anti-human, monoclonal *

V100125 50 ug
EUR 306
  • R-phrase:
  • H-Phrase:
  • Symbol for dangerous compounds:
  • UNSPEC Code:

Anti-Procalcitonin antibody *Mouse anti-human, monoclonal *

V100126 1 mg
EUR 393
  • R-phrase:
  • H-Phrase:
  • Symbol for dangerous compounds:
  • UNSPEC Code:

Fap sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3418002 1.0 ug DNA
EUR 154

Fap sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3418003 1.0 ug DNA
EUR 154

Fap sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3418004 1.0 ug DNA
EUR 154

FAP Protein Vector (Mouse) (pPB-C-His)

PV178330 500 ng
EUR 1065

FAP Protein Vector (Mouse) (pPB-N-His)

PV178331 500 ng
EUR 1065

FAP Protein Vector (Mouse) (pPM-C-HA)

PV178332 500 ng
EUR 1065

FAP Protein Vector (Mouse) (pPM-C-His)

PV178333 500 ng
EUR 1065

Mouse Anti Mouse Nc1.1 Monoclonal Antibody,RPE

DMABT-54461MM 25 TEST
EUR 429

Mouse Anti Mouse Cd28 Monoclonal Antibody,RPE

CABT-48085MM 100 TEST
EUR 533

Mouse Anti Mouse Cd14 Monoclonal Antibody,RPE

CABT-45608MM 100 TEST
EUR 533

Mouse Anti Mouse Cd44 Monoclonal Antibody,RPE

CABT-46109MM 100 TEST
EUR 533

Mouse anti-Dengue NS1 Monoclonal Antibody

DMAB-A004 1 mg
EUR 579

Mouse Anti-Adenovirus hexon Monoclonal Antibody

DMAB2931 1 mg
EUR 1339

Mouse Anti-Adenovirus hexon Monoclonal Antibody

DMAB2932 1 mg
EUR 1079

Mouse Anti-Adenovirus hexon Monoclonal Antibody

DMAB2933 1 mg
EUR 1339

Mouse Anti-Adenovirus hexon Monoclonal Antibody

DMAB2936 1 mg
EUR 1079

Mouse Anti-Adenovirus hexon Monoclonal Antibody

DMAB2937 0.1 mg
EUR 903

Mouse Anti-Adenovirus hexon Monoclonal Antibody

DMAB2938-05mg 0.5 mg
EUR 897

Mouse Anti-Adenovirus hexon Monoclonal Antibody

DMAB2938-1mg 1 mg
EUR 1339

Mouse Anti-Adenovirus hexon Monoclonal Antibody

DMAB2939 1 mg
EUR 903

Mouse Anti-Human Antithrombin Monoclonal Antibody

DMAB2995MH 0.5 mg
EUR 1469

Mouse Anti-Bacteroides thetaiotaomicron Monoclonal Antibody

DMAB3036 0.1 mg
EUR 689

Mouse Anti-Borrelia garinii Monoclonal Antibody

DMAB3061 1 mg
EUR 741

Mouse Anti-Brucella abortus Monoclonal Antibody

DMAB3068-05mg 0.5 mg
EUR 780

Mouse Anti-Brucella abortus Monoclonal Antibody

DMAB3068-1mg 1 mg
EUR 1099

Mouse Anti-Campylobacter jejuni Monoclonal Antibody

DMAB3082 1 mg
EUR 1294

Mouse Anti-Campylobacter jejuni Monoclonal Antibody

DMAB3083 1 mg
EUR 1294

Mouse Anti-Campylobacter jejuni Monoclonal Antibody

DMAB3084 1 mg
EUR 903

Mouse Anti-Campylobacter jejuni Monoclonal Antibody

DMAB3085 1 mg
EUR 903

Mouse Anti-Giardia lamblia Monoclonal Antibody

DMAB3408 1 mg
EUR 1339

Mouse Anti-Giardia lamblia Monoclonal Antibody

DMAB3409 1 mg
EUR 833

Mouse Anti-Giardia lamblia Monoclonal Antibody

DMAB3410-05mg 0.5 mg
EUR 969

Mouse Anti-Giardia lamblia Monoclonal Antibody

DMAB3410-1mg 1 mg
EUR 1469

Mouse Anti-Giardia lamblia Monoclonal Antibody

DMAB3411-05mg 0.5 mg
EUR 969

Mouse Anti-Giardia lamblia Monoclonal Antibody

DMAB3411-1mg 1 mg
EUR 1469

Mouse Anti-Giardia lamblia Monoclonal Antibody

DMAB3412-05mg 0.5 mg
EUR 969

Mouse Anti-Giardia lamblia Monoclonal Antibody

DMAB3412-1mg 1 mg
EUR 1469

Mouse Anti-Canine Heartworm Monoclonal Antibody

DMAB3453 1 mg
EUR 833

Mouse Anti-Helicobacter pylori Monoclonal Antibody

DMAB3470 1 mg
EUR 1339

Mouse Anti-Helicobacter pylori Monoclonal Antibody

DMAB3471 1 mg
EUR 1339

Mouse Anti-Helicobacter pylori Monoclonal Antibody

DMAB3472 1 mg
EUR 955

Mouse Anti-HFRS Virus Monoclonal Antibody

DMAB3483-05mg 0.5 mg
EUR 897

Mouse Anti-HFRS Virus Monoclonal Antibody

DMAB3483-1mg 1 mg
EUR 1339

Mouse Anti-HFRS Virus Monoclonal Antibody

DMAB3484-05mg 0.5 mg
EUR 897

Mouse Anti-HFRS Virus Monoclonal Antibody

DMAB3484-1mg 1 mg
EUR 1339

Mouse Anti-Japanese Encephalitis Monoclonal Antibody

DMAB3846 50ug
EUR 725

Mouse Anti-Marburg Virus Monoclonal Antibody

DMAB3899-05mg 0.5 mg
EUR 897

Mouse Anti-Marburg Virus Monoclonal Antibody

DMAB3899-1mg 1 mg
EUR 1339

Mouse Anti-Marburg Virus Monoclonal Antibody

DMAB3900-05mg 0.5 mg
EUR 897

Mouse Anti-Marburg Virus Monoclonal Antibody

DMAB3900-1mg 1 mg
EUR 1339

Mouse Anti-Marburg Virus Monoclonal Antibody

DMAB3901-05mg 0.5 mg
EUR 897

Mouse Anti-Marburg Virus Monoclonal Antibody

DMAB3901-1mg 1 mg
EUR 1339

Mouse Anti-Marburg Virus Monoclonal Antibody

DMAB3902-05mg 0.5 mg
EUR 897

Mouse Anti-Marburg Virus Monoclonal Antibody

DMAB3902-1mg 1 mg
EUR 1339

Mouse Anti-Mycobacterium avium Monoclonal Antibody

DMAB3938 0.2 mg
EUR 741

Mouse Anti-Mycobacterium tuberculosis Monoclonal Antibody

DMAB3972-05mg 0.5 mg
EUR 969

Mouse Anti-Mycobacterium tuberculosis Monoclonal Antibody

DMAB3972-1mg 1 mg
EUR 1469

Mouse Anti-Mycoplasma bovis Monoclonal Antibody

DMAB3973-05mg 0.5 mg
EUR 897

Mouse Anti-Mycoplasma bovis Monoclonal Antibody

DMAB3973-1mg 1 mg
EUR 1339

Mouse Anti-Mycoplasma hominis Monoclonal Antibody

DMAB3976 1 mg
EUR 1339

Mouse Anti-Mycoplasma pneumoniae Monoclonal Antibody

DMAB3978 1 mg
EUR 1339

Mouse Anti-Mycoplasma pneumoniae Monoclonal Antibody

DMAB3979 1 mg
EUR 1339

Mouse Anti-Neisseria gonorrhoeae Monoclonal Antibody

DMAB3990-05mg 0.5 mg
EUR 897

Mouse Anti-Neisseria gonorrhoeae Monoclonal Antibody

DMAB3990-1mg 1 mg
EUR 1339

Mouse Anti-Neisseria gonorrhoeae Monoclonal Antibody

DMAB3991 0.2 mg
EUR 833

Mouse Anti-Neisseria gonorrhoeae Monoclonal Antibody

DMAB3992 0.2 mg
EUR 833

Mouse Anti-Neisseria gonorrhoeae Monoclonal Antibody

DMAB3993-05mg 0.5 mg
EUR 897

Mouse Anti-Neisseria gonorrhoeae Monoclonal Antibody

DMAB3993-1mg 1 mg
EUR 1339

Mouse Anti-Norovirus capsid Monoclonal Antibody

DMAB4016-05mg 0.5 mg
EUR 897

Mouse Anti-Norovirus capsid Monoclonal Antibody

DMAB4016-1mg 1 mg
EUR 1339

Mouse Anti-Norovirus capsid Monoclonal Antibody

DMAB4017-05mg 0.5 mg
EUR 897

Mouse Anti-Norovirus capsid Monoclonal Antibody

DMAB4017-1mg 1 mg
EUR 1339

Mouse Anti-Canine Parvovirus Monoclonal Antibody

DMAB4049 1 mg
EUR 903

Mouse Anti-Canine Parvovirus Monoclonal Antibody

DMAB4050 1 mg
EUR 903

Mouse Anti-Streptococcus agalactiae Monoclonal Antibody

DMAB4325-05mg 0.5 mg
EUR 897

Mouse Anti-Streptococcus agalactiae Monoclonal Antibody

DMAB4325-1mg 1 mg
EUR 1339

Mouse Anti-Strep A Monoclonal Antibody

DMAB4326-05mg 0.5 mg
EUR 897

Mouse Anti-Strep A Monoclonal Antibody

DMAB4326-1mg 1 mg
EUR 1339

Mouse Anti-Strep A Monoclonal Antibody

DMAB4329-05mg 0.5 mg
EUR 1099

Mouse Anti-Strep A Monoclonal Antibody

DMAB4329-1mg 1 mg
EUR 1729

Mouse Anti-Toxoplasma gondii Monoclonal Antibody

DMAB4405 1 mg
EUR 903

Mouse Anti-Treponema pallidum Monoclonal Antibody

DMAB4422 1 mg
EUR 1294

Mouse Anti-Trichomonas Foetus Monoclonal Antibody

DMAB4427 1 mg
EUR 1339

Mouse Anti-Trichomonas Vaginalis Monoclonal Antibody

DMAB4428 1 mg
EUR 1339

Mouse Anti-Trichomonas Vaginalis Monoclonal Antibody

DMAB4429 1 mg
EUR 1339

Mouse Anti-Trichomonas vaginalis Monoclonal Antibody

DMAB4431 1 mg
EUR 1305

Mouse Anti-Trichomonas Vaginalis Monoclonal Antibody

DMAB4432 1 mg
EUR 1339

Mouse Anti-Vaccinia Virus Monoclonal Antibody

DMAB4487 1 mg
EUR 1339

Mouse Anti-Vaccinia Virus Monoclonal Antibody

DMAB4488 1 mg
EUR 1339

Mouse Anti-VZV (155kDa) Monoclonal Antibody

DMAB4498 0.5 mg
EUR 833

Mouse Anti-VZV (gpII) Monoclonal Antibody

DMAB4501 0.5 mg
EUR 781

Mouse Anti-VZV gpIII Monoclonal Antibody

DMAB4502 0.5 mg
EUR 833

Mouse Anti-VZV (gpIV) Monoclonal Antibody

DMAB4503 0.5 mg
EUR 833

Mouse Anti Bovine Cd4 Monoclonal Antibody

DMABT-45059MB 2 ml
EUR 741

Mouse Anti Cat Cd4 Monoclonal Antibody

DMABT-45062MC 2 ml
EUR 741

Mouse Anti Cat Cd4 Monoclonal Antibody

DMABT-45063MC 2 ml
EUR 741

Mouse Anti Chicken Cd4 Monoclonal Antibody

DMABT-45065MC 0.25 mg
EUR 741

Mouse Anti Duck Cd4 Monoclonal Antibody

DMABT-45075MD 0.25 mg
EUR 741

Mouse Anti Horse Cd4 Monoclonal Antibody

DMABT-45079MH 2 ml
EUR 741

Mouse Anti Cat Cd5 Monoclonal Antibody

DMABT-45181MC 2 ml
EUR 741

Mouse Anti Chicken Cd5 Monoclonal Antibody

DMABT-45183MC 0.25 mg
EUR 741

Mouse Anti Pig Cd5 Monoclonal Antibody

DMABT-45218MP 0.25 mg
EUR 741

Mouse Anti Sheep Cd5 Monoclonal Antibody

DMABT-45230MS 0.25 mg
EUR 741

Mouse Anti Sheep Cd8 Monoclonal Antibody

DMABT-45290MS 2 ml
EUR 741

Mouse Anti Pig Cd14 Monoclonal Antibody

DMABT-45611MP 2 ml
EUR 741

Mouse Anti Human Cd15 Monoclonal Antibody

DMABT-45615MH 25 µg
EUR 372

Mouse Anti Human Cd15 Monoclonal Antibody

DMABT-45616MH 0.2 mg
EUR 741

Mouse Anti Human Cd15 Monoclonal Antibody

DMABT-45617MH 25 µg
EUR 429

Mouse Anti Human Cd15 Monoclonal Antibody

DMABT-45618MH 0.2 mg
EUR 741

Mouse Anti Sheep Cd44 Monoclonal Antibody

DMABT-46125MS 0.25 mg
EUR 741

Mouse Anti Sheep Cd58 Monoclonal Antibody

DMABT-46502MS 0.25 mg
EUR 741

Mouse Anti Sheep Cd58 Monoclonal Antibody

DMABT-46503MS 2 ml
EUR 741

Mouse Anti Rat Cd68 Monoclonal Antibody

DMABT-46627MR 0.25 mg
EUR 741

Mouse Anti Rat Cd68 Monoclonal Antibody

DMABT-46628MR 0.1 mg
EUR 559

Mouse Anti Rat Cd163 Monoclonal Antibody

DMABT-47170MR 0.25 mg
EUR 741

Mouse Anti Rat Cd163 Monoclonal Antibody

DMABT-47171MR 0.1 mg
EUR 559

Mouse Anti Hamster Marco Monoclonal Antibody

DMABT-47716MH 0.25 mg
EUR 741

Mouse Anti Bovine Cd2 Monoclonal Antibody

DMABT-47964MB 0.25 ml
EUR 741

Mouse Anti Bovine Cd2 Monoclonal Antibody

DMABT-47966MB 0.25 mg
EUR 741

Mouse Anti Sheep Cd2 Monoclonal Antibody

DMABT-48002MS 0.25 mg
EUR 741

Mouse Anti Sheep Cd2 Monoclonal Antibody

DMABT-48003MS 2 ml
EUR 741

Mouse Anti Chicken Cd28 Monoclonal Antibody

DMABT-48061MC 0.25 mg
EUR 861

Mouse Anti Monkey Iga Monoclonal Antibody

DMABT-48823MM 0.25 mg
EUR 767

Mouse Anti Dog Ige Monoclonal Antibody

DMABT-48838MD 0.25 mg
EUR 767

Mouse Anti Progesterone/Ohp Monoclonal Antibody

DMABT-49180MP 0.2 mg
EUR 580

Mouse Anti Progesterone/Ohp Monoclonal Antibody

DMABT-49181MP 0.2 mg
EUR 580

Mouse Anti Progesterone/Ohp Monoclonal Antibody

DMABT-49182MP 0.2 mg
EUR 580

Mouse Anti Human Macrophages Monoclonal Antibody

DMABT-49597MH 0.2 ml
EUR 403

Mouse Anti Human Macrophages Monoclonal Antibody

DMABT-49598MH 2 ml
EUR 840

Mouse Anti Rat Cd6 Monoclonal Antibody

DMABT-49704MR 0.25 mg
EUR 543

Mouse Anti Rat Cd6 Monoclonal Antibody

DMABT-49705MR 0.1 mg
EUR 429

Mouse Anti Rat Endothelium Monoclonal Antibody

DMABT-49806MR 0.25 mg
EUR 564

Mouse Anti Brdu Monoclonal Antibody,FITC

DMABT-50294MB 50 µg
EUR 559

Mouse Anti Growth Cone Monoclonal Antibody

DMABT-50824MG 2 ml
EUR 767

Mouse Anti Adenovirus Hexon Monoclonal Antibody

DMABT-51068MA 0.2 mg
EUR 663

Mouse Anti Adenovirus Hexon Monoclonal Antibody

DMABT-51069MA 0.2 mg
EUR 767

Mouse Anti Adenovirus Hexon Monoclonal Antibody

DMABT-51070MA 0.2 mg
EUR 767

Mouse Anti Adenovirus Hexon Monoclonal Antibody

DMABT-51072MA 0.2 mg
EUR 663

Mouse Anti Aspergillus Spp Monoclonal Antibody

DMABT-51087MA 0.25 mg
EUR 741

Mouse Anti Borrelia Burgdorferi Monoclonal Antibody

DMABT-51101MB 0.2 mg
EUR 710

Mouse Anti Borrelia Burgdorferi Monoclonal Antibody

DMABT-51102MB 0.2 mg
EUR 663

Mouse Anti Borrelia Burgdorferi Monoclonal Antibody

DMABT-51103MB 0.1 mg
EUR 892

Mouse Anti Brucella Abortus Monoclonal Antibody

DMABT-51110MB 0.2 mg
EUR 741

Mouse Anti Brucella Abortus Monoclonal Antibody

DMABT-51111MB 0.2 mg
EUR 741

Mouse Anti Brucella Abortus Monoclonal Antibody

DMABT-51112MB 0.2 mg
EUR 741

Mouse Anti Brucella Abortus Monoclonal Antibody

DMABT-51113MB 0.2 mg
EUR 741

Mouse Anti Brucella Abortus Monoclonal Antibody

DMABT-51114MB 0.2 mg
EUR 741

Mouse Anti Brucella Abortus Monoclonal Antibody

DMABT-51115MB 0.2 mg
EUR 710

Mouse Anti Brucella Abortus Monoclonal Antibody

DMABT-51116MB 0.1 mg
EUR 767

Mouse Anti Campylobacter Jejuni Monoclonal Antibody

DMABT-51127MC 0.2 mg
EUR 663

Mouse Anti Campylobacter Jejuni Monoclonal Antibody

DMABT-51131MC 0.1 mg
EUR 767

Mouse Anti Candida Albicans Monoclonal Antibody

DMABT-51133MC 0.2 mg
EUR 715

Mouse Anti Candida Albicans Monoclonal Antibody

DMABT-51135MC 0.2 mg
EUR 741

Mouse Anti Candida Albicans Monoclonal Antibody

DMABT-51136MC 0.1 mg
EUR 892

Mouse Anti Canine Heartworm Monoclonal Antibody

DMABT-51140MC 0.25 mg
EUR 767

Mouse Anti Canine Parvovirus Monoclonal Antibody

DMABT-51142MC 0.1 mg
EUR 767

Mouse Anti Canine Parvovirus Monoclonal Antibody

DMABT-51143MC 0.1 mg
EUR 767

Mouse Anti Chlamydia Lps Monoclonal Antibody

DMABT-51147MC 0.5 mg
EUR 881

Mouse Anti Cholera Haemolysin Monoclonal Antibody

DMABT-51163MC 0.2 mg
EUR 710

Mouse Anti Dengue Virus Monoclonal Antibody

DMABT-51211MD 0.25 mg
EUR 767

Mouse Anti Dengue Virus Monoclonal Antibody

DMABT-51212MD 0.1 mg
EUR 892

Mouse Anti Diphtheria Toxin Monoclonal Antibody

DMABT-51215MD 0.1 mg
EUR 881

Mouse Anti Enterobacter Cloacae Monoclonal Antibody

DMABT-51224ME 0.2 mg
EUR 710

Mouse Anti Escherichia Coli Monoclonal Antibody

DMABT-51242ME 0.1 mg
EUR 892

Mouse Anti Giardia Lamblia Monoclonal Antibody

DMABT-51288MG 0.1 mg
EUR 767

Mouse Anti Giardia Lamblia Monoclonal Antibody

DMABT-51289MG 0.1 mg
EUR 767

Mouse Anti Helicobacter Pylori Monoclonal Antibody

DMABT-51299MH 0.2 mg
EUR 767

Mouse Anti Helicobacter Pylori Monoclonal Antibody

DMABT-51301MH 0.2 mg
EUR 767

Mouse Anti Helicobacter Pylori Monoclonal Antibody

DMABT-51302MH 0.2 mg
EUR 767

Mouse Anti Helicobacter Pylori Monoclonal Antibody

DMABT-51303MH 0.1 mg
EUR 892

Mouse Anti Hepatitis A Monoclonal Antibody

DMABT-51306MH 0.1 mg
EUR 892

Mouse Anti Hepatitis C Monoclonal Antibody

DMABT-51331MH 50 µg
EUR 861

Mouse Anti Influenza A Monoclonal Antibody

DMABT-51378MI 0.2 mg
EUR 767

Mouse Anti Influenza B Monoclonal Antibody

DMABT-51398MI 0.2 mg
EUR 715

Mouse Anti Influenza B Monoclonal Antibody

DMABT-51400MI 0.2 mg
EUR 663

Mouse Anti Influenza B Monoclonal Antibody

DMABT-51401MI 0.2 mg
EUR 741

Mouse Anti Listeria Monocytogenes Monoclonal Antibody

DMABT-51431ML 0.2 mg
EUR 663

Mouse Anti Listeria Monocytogenes Monoclonal Antibody

DMABT-51432ML 0.2 mg
EUR 663

Mouse Anti Mumps Virus Monoclonal Antibody

DMABT-51439MM 0.1 mg
EUR 892

Mouse Anti Mycobacterium Avium Monoclonal Antibody

DMABT-51440MM 0.2 mg
EUR 715

Mouse Anti Mycoplasma Bovis Monoclonal Antibody

DMABT-51449MM 0.2 mg
EUR 663

Mouse Anti Neisseria Gonorrhoeae Monoclonal Antibody

DMABT-51450MN 0.2 mg
EUR 715

Mouse Anti Neisseria Gonorrhoeae Monoclonal Antibody

DMABT-51452MN 0.1 mg
EUR 892

Mouse Anti Parvovirus B19 Monoclonal Antibody

DMABT-51485MP 0.1 mg
EUR 892

Mouse Anti Pseudomonas Aeruginosa Monoclonal Antibody

DMABT-51500MP 0.2 mg
EUR 741

Mouse Anti Rabies Virus Monoclonal Antibody

DMABT-51509MR 1 mg
EUR 767

Mouse Anti Rabies Virus Monoclonal Antibody

DMABT-51510MR 0.1 mg
EUR 892

Mouse Anti Rubella Virus Monoclonal Antibody

DMABT-51535MR 0.2 mg
EUR 663

Mouse Anti Salmonella Spp Monoclonal Antibody

DMABT-51552MS 0.1 mg
EUR 892

Mouse Anti Staphylococcus Aureus Monoclonal Antibody

DMABT-51574MS 0.1 ml
EUR 861

Mouse Anti Streptococcus Agalactiae Monoclonal Antibody

DMABT-51600MS 0.2 mg
EUR 767

Mouse Anti Streptococcus Pneumoniae Monoclonal Antibody

DMABT-51604MS 0.2 mg
EUR 767

Mouse Anti Streptococcus Pyogenes Monoclonal Antibody

DMABT-51608MS 0.2 mg
EUR 580

Mouse Anti Toxoplasma Gondii Monoclonal Antibody

DMABT-51612MT 0.1 mg
EUR 944

Mouse Anti Treponema Pallidum Monoclonal Antibody

DMABT-51615MT 0.2 mg
EUR 741

Mouse Anti Vaccinia Virus Monoclonal Antibody

DMABT-51622MV 0.2 mg
EUR 767

Mouse Anti Varicella Zoster Monoclonal Antibody

DMABT-51624MV 0.1 mg
EUR 892

Mouse Anti Bovine Cd6 Monoclonal Antibody

DMABT-51846MB 0.25 ml
EUR 741

Mouse Anti Bovine Cd6 Monoclonal Antibody

DMABT-51847MB 0.25 mg
EUR 741

Mouse Anti Bovine Iga Monoclonal Antibody

DMABT-51899MB 0.25 mg
EUR 741

Mouse Anti Bovine Igg Monoclonal Antibody

DMABT-51902MB 0.25 mg
EUR 741

Mouse Anti Bovine Igg1 Monoclonal Antibody

DMABT-51905MB 0.25 mg
EUR 741

Mouse Anti Bovine Igg1 Monoclonal Antibody

DMABT-51906MB 2 ml
EUR 741

Mouse Anti Bovine Igg2 Monoclonal Antibody

DMABT-51908MB 0.25 mg
EUR 741

Mouse Anti Bovine Igg2 Monoclonal Antibody

DMABT-51909MB 2 ml
EUR 741

Mouse Anti Bovine Igm Monoclonal Antibody

DMABT-51911MB 0.25 mg
EUR 741

Mouse Anti Dog Iga Monoclonal Antibody

DMABT-51916MD 2 ml
EUR 741

Mouse Anti Pig Iga Monoclonal Antibody

DMABT-51917MP 0.25 mg
EUR 767

Mouse Anti Dog Ige Monoclonal Antibody

DMABT-51918MD 0.25 mg
EUR 767

Mouse Anti Dog Igg2 Monoclonal Antibody

DMABT-51920MD 0.25 mg
EUR 741

Mouse Anti Dog Igg2 Monoclonal Antibody

DMABT-51921MD 0.25 mg
EUR 741

Mouse Anti Chicken Cd8a Monoclonal Antibody

DMABT-51945MC 0.25 mg
EUR 741

Mouse Anti Chicken Cd44 Monoclonal Antibody

DMABT-51947MC 0.25 mg
EUR 861

Mouse Anti Chicken Iga Monoclonal Antibody

DMABT-51958MC 0.25 mg
EUR 741

Mouse Anti Chicken Igm Monoclonal Antibody

DMABT-51959MC 0.25 mg
EUR 741

Mouse Anti Chicken Igy Monoclonal Antibody

DMABT-51960MC 0.25 mg
EUR 741

Mouse Anti Horse Iga Monoclonal Antibody

DMABT-51963MH 2 ml
EUR 741

Mouse Anti Cat Iga Monoclonal Antibody

DMABT-51971MC 0.25 mg
EUR 767

Mouse Anti Cat Iga Monoclonal Antibody

DMABT-51973MC 2 ml
EUR 741

Mouse Anti Cat Igg Monoclonal Antibody

DMABT-51974MC 0.25 mg
EUR 767

Mouse Anti Cat Igg Monoclonal Antibody

DMABT-51975MC 2 ml
EUR 741

Mouse Anti Cat Igm Monoclonal Antibody

DMABT-51977MC 2 ml
EUR 741

Mouse Anti Sheep Igm Monoclonal Antibody

DMABT-51994MS 0.25 mg
EUR 741

Mouse Anti Sheep Igm Monoclonal Antibody

DMABT-51995MS 2 ml
EUR 741

Mouse Anti Pig Iga Monoclonal Antibody

DMABT-52031MP 2 ml
EUR 741

Mouse Anti Pig Igg1 Monoclonal Antibody

DMABT-52033MP 2 ml
EUR 741

Mouse Anti Pig Igm Monoclonal Antibody

DMABT-52035MP 2 ml
EUR 741

Mouse Anti Human Cytokeratin Monoclonal Antibody

DMABT-52180MH 0.5 ml
EUR 1209

Mouse Anti Human Dna Monoclonal Antibody

DMABT-52214MH 0.1 mg
EUR 767

Mouse Anti Fk-506 Monoclonal Antibody

DMABT-52215MF 0.2 mg
EUR 725

Mouse Anti V5-Tag Monoclonal Antibody

DMABT-54745MV 0.1 mg
EUR 533

Mouse Anti V5-Tag Monoclonal Antibody

DMABT-54746MV 1 mg
EUR 965

Mouse Anti V5-Tag Monoclonal Antibody

DMABT-54748MV 0.1 mg
EUR 533

Mouse Anti V5-Tag Monoclonal Antibody

DMABT-54749MV 1 mg
EUR 965

Mouse Anti V5-Tag Monoclonal Antibody

DMABT-54750MV 0.1 mg
EUR 533

Mouse Anti V5-Tag Monoclonal Antibody

DMABT-54751MV 1 mg
EUR 965

Mouse Anti V5-Tag Monoclonal Antibody

DMABT-54755MV 0.1 mg
EUR 533

Mouse Anti V5-Tag Monoclonal Antibody

DMABT-54756MV 1 mg
EUR 965

Mouse Anti V5-Tag Monoclonal Antibody

DMABT-54760MV 0.1 mg
EUR 533

Mouse Anti V5-Tag Monoclonal Antibody

DMABT-54761MV 1 mg
EUR 965

Mouse Anti Folic Acid Monoclonal Antibody

DMABT-54808MF 0.2 mg
EUR 710

Mouse Anti Phosphotyrosine Monoclonal Antibody,HRP

DMABT-54832MP 0.5 ml
EUR 559

Mouse Anti M13 Bacteriophage Monoclonal Antibody

DMABT-54839MM 0.25 mg
EUR 944

Mouse Anti Phosphotyrosine Monoclonal Antibody,FITC

DMABT-54844MP 0.5 mg
EUR 944

Mouse Anti Phosphotyrosine Monoclonal Antibody,RPE

DMABT-54845MP 0.1 mg
EUR 819

Mouse Anti Cyclosporin A Monoclonal Antibody

DMABT-54854MC 0.2 mg
EUR 663

Mouse Anti Varicella Zoster Monoclonal Antibody

DMABT-54878MV 0.2 mg
EUR 767

Mouse Anti Fk-506 Monoclonal Antibody

DMABT-54892MF 0.2 mg
EUR 741

Mouse anti Mycoplasma genitalium Monoclonal Antibody

DCAB-TJ100 1 mg
EUR 1294

Mouse anti Mycoplasma genitalium Monoclonal Antibody

DCAB-TJ101 1 mg
EUR 1294

Mouse anti Diphtheria Toxin Monoclonal Antibody

DCAB-TJ130 1 mg
EUR 741

Mouse anti Diphtheria Toxin Monoclonal Antibody

DCAB-TJ140 1 mg
EUR 741

Mouse Anti Rat Cd53 Monoclonal Antibody

CABT-46459MR 0.1 mg
EUR 429

Mouse Anti Human Cd54 Monoclonal Antibody

CABT-46474MH 0.2 mg
EUR 741

Mouse Anti Human Cd58 Monoclonal Antibody

CABT-46493MH 0.1 mg
EUR 533

Mouse Anti Human Cd58 Monoclonal Antibody

CABT-46500MH 0.2 mg
EUR 892

Mouse Anti Rat Cd59 Monoclonal Antibody

CABT-46527MR 0.1 mg
EUR 429

Mouse Anti Rat Cd59 Monoclonal Antibody

CABT-46528MR 0.25 mg
EUR 715

Mouse Anti Human Cd64 Monoclonal Antibody

CABT-46594MH 0.2 mg
EUR 741

Rat Anti Mouse Cd70 Monoclonal Antibody

CABT-46652RM 0.1 mg
EUR 455

Rat Anti Mouse Cd80 Monoclonal Antibody

CABT-46717RM 0.1 mg
EUR 455

Rat Anti Mouse Cd83 Monoclonal Antibody

CABT-46746RM 0.1 mg
EUR 559

Mouse Anti Human Cd84 Monoclonal Antibody

CABT-46755MH 0.2 mg
EUR 741

Rat Anti Mouse Cd86 Monoclonal Antibody

CABT-46789RM 0.1 mg
EUR 455

Mouse Anti Human Cd93 Monoclonal Antibody

CABT-46886MH 0.1 mg
EUR 944

Mouse Anti Human Cd95 Monoclonal Antibody

CABT-46896MH 0.2 mg
EUR 741

Mouse Anti Human Cd97 Monoclonal Antibody

CABT-46901MH 0.2 mg
EUR 767

Mouse Anti Human Cd105 Monoclonal Antibody

CABT-46942MH 0.2 mg
EUR 741

Rat Anti Mouse Cd115 Monoclonal Antibody

CABT-47002RM 0.1 mg
EUR 455

Mouse Anti Human Cd142 Monoclonal Antibody

CABT-47048MH 0.2 mg
EUR 741

Mouse Anti Human Cd143 Monoclonal Antibody

CABT-47050MH 1 ml
EUR 767

Mouse Anti Human Cd143 Monoclonal Antibody

CABT-47057MH 1 ml
EUR 767

Mouse Anti Rat Cd147 Monoclonal Antibody

CABT-47096MR 2 ml
EUR 533

Hamster Anti Mouse Cd152 Monoclonal Antibody

CABT-47114HM 0.1 mg
EUR 455

Hamster Anti Mouse Cd154 Monoclonal Antibody

CABT-47157HM 0.1 mg
EUR 455

Mouse Anti Human Cd163 Monoclonal Antibody

CABT-47162MH 25 µg
EUR 372

Mouse Anti Human Cd163 Monoclonal Antibody

CABT-47163MH 0.2 mg
EUR 881

Mouse Anti Human Cd178 Monoclonal Antibody

CABT-47209MH 0.1 mg
EUR 533

Hamster Anti Mouse Cd178 Monoclonal Antibody

CABT-47221HM 0.1 mg
EUR 455

Rat Anti Mouse Cd180 Monoclonal Antibody

CABT-47228RM 25 µg
EUR 429

Rat Anti Mouse Cd180 Monoclonal Antibody

CABT-47229RM 0.25 mg
EUR 1053

Hamster Anti Mouse Cd195 Monoclonal Antibody

CABT-47249HM 0.25 mg
EUR 663

Rat Anti Mouse Cd200 Monoclonal Antibody

CABT-47285RM 0.1 mg
EUR 455

Mouse Anti Rat Cd200 Monoclonal Antibody

CABT-47291MR 0.1 mg
EUR 429

Mouse Anti Human Cd200r Monoclonal Antibody

CABT-47309MH 0.2 mg
EUR 767

Mouse Anti Human Cd209 Monoclonal Antibody

CABT-47382MH 0.2 mg
EUR 741

Mouse Anti Human Cd243 Monoclonal Antibody

CABT-47395MH 0.1 mg
EUR 580

Mouse Anti Human Cd274 Monoclonal Antibody

CABT-47434MH 0.2 mg
EUR 767

Mouse Anti Human Cd275 Monoclonal Antibody

CABT-47446MH 0.1 mg
EUR 559

Mouse Anti Human Cd300a Monoclonal Antibody

CABT-47528MH 0.1 mg
EUR 715

Rat Anti Mouse Cdw199 Monoclonal Antibody

CABT-47544RM 0.1 mg
EUR 580

Mouse Anti Human Defensin Monoclonal Antibody

CABT-47897MH 0.1 mg
EUR 1053

Mouse Anti Human C3b Monoclonal Antibody

CABT-47909MH 50 µg
EUR 1089

Mouse Anti Human C3c Monoclonal Antibody

CABT-47911MH 0.1 mg
EUR 840

Mouse Anti Human C3d Monoclonal Antibody

CABT-47912MH 0.1 ml
EUR 840

Mouse Anti Human C4bp Monoclonal Antibody

CABT-47915MH 0.1 mg
EUR 861

Mouse Anti Human C4c Monoclonal Antibody

CABT-47916MH 0.1 mg
EUR 840

Mouse Anti Human C4d Monoclonal Antibody

CABT-47918MH 0.1 mg
EUR 1261

Mouse Anti Human C5 Monoclonal Antibody

CABT-47920MH 0.1 mg
EUR 840

Mouse Anti Human C7 Monoclonal Antibody

CABT-47921MH 0.1 mg
EUR 840

Mouse Anti Human C8 Monoclonal Antibody

CABT-47922MH 0.1 mg
EUR 840

Mouse Anti Human C9 Monoclonal Antibody

CABT-47923MH 0.1 mg
EUR 840

Mouse Anti Human Cd55 Monoclonal Antibody

CABT-47934MH 0.2 mg
EUR 741

Mouse Anti Human Clusterin Monoclonal Antibody

CABT-47935MH 0.1 mg
EUR 944

Mouse Anti Human Cd2 Monoclonal Antibody

CABT-47979MH 0.1 ml
EUR 455

Mouse Anti Human Cd2 Monoclonal Antibody

CABT-47982MH 0.1 mg
EUR 559

Rat Anti Mouse Cd2 Monoclonal Antibody

CABT-47990RM 2 ml
EUR 663

Rat Anti Mouse Cd25 Monoclonal Antibody

CABT-48028RM 0.1 mg
EUR 455

Mouse Anti Pig Cd25 Monoclonal Antibody

CABT-48031MP 2 ml
EUR 741

Mouse Anti Rat Cd25 Monoclonal Antibody

CABT-48041MR 0.1 mg
EUR 429

Mouse Anti Sheep Cd25 Monoclonal Antibody

CABT-48048MS 0.25 mg
EUR 741

Mouse Anti Chicken Cd28 Monoclonal Antibody

CABT-48059MC 0.25 mg
EUR 741

Hamster Anti Mouse Cd28 Monoclonal Antibody

CABT-48079HM 0.2 mg
EUR 663

Mouse Anti Human Cd44v4 Monoclonal Antibody

CABT-48094MH 0.1 mg
EUR 710

Rat Anti Mouse Cd44v4 Monoclonal Antibody

CABT-48095RM 0.1 mg
EUR 663

Rat Anti Mouse Cd44v6 Monoclonal Antibody

CABT-48099RM 0.1 mg
EUR 663

Mouse Anti Human Cd44v7 Monoclonal Antibody

CABT-48101MH 0.1 mg
EUR 710

Mouse Anti Human Cd44v10 Monoclonal Antibody

CABT-48104MH 0.1 mg
EUR 710

Mouse Anti Bovine Cd63 Monoclonal Antibody

CABT-48224MB 0.25 mg
EUR 741

Hamster Anti Mouse Cd81 Monoclonal Antibody

CABT-48269HM 0.1 mg