Rabbit Polyclonal Anti Gper

Lab Reagents

Human IgG antibody Laboratories manufactures the rabbit polyclonal anti gper reagents distributed by Genprice. The Rabbit Polyclonal Anti Gper reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact rabbit polyclonal. Other Rabbit products are available in stock. Specificity: Rabbit Category: Polyclonal Group: Anti Gper

Anti Gper information

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RDR-GPER-Hu-48Tests 48 Tests
EUR 544

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RDR-GPER-Hu-96Tests 96 Tests
EUR 756

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RDR-GPER-Mu-48Tests 48 Tests
EUR 557

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RDR-GPER-Mu-96Tests 96 Tests
EUR 774

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RD-GPER-Hu-48Tests 48 Tests
EUR 521

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RD-GPER-Hu-96Tests 96 Tests
EUR 723

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RD-GPER-Mu-48Tests 48 Tests
EUR 533

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RD-GPER-Mu-96Tests 96 Tests
EUR 740

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Gper/ Rat Gper ELISA Kit

ELI-03937r 96 Tests
EUR 886

Polyclonal GPER Antibody (C-term)

APR07130G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPER (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal GPER antibody - C-terminal region

AMRa00042G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPER - C-terminal region. This antibody is tested and proven to work in the following applications:

GPER cloning plasmid

CSB-CL859933HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1128
  • Sequence: atggatgtgacttcccaagcccggggcgtgggcctggagatgtacctaggcaccgcgcagcctgcggcccccaacaccacctcccccgagctcaacctgtcccacccgctcctgggcaccgccctggccaatgggacaggtgagctctcggagcaccagcagtacgtgatcggcc
  • Show more
Description: A cloning plasmid for the GPER gene.

GPER ELISA KIT|Human

EF004242 96 Tests
EUR 689

GPER Recombinant Protein (Human)

RP013738 100 ug Ask for price